Genetic Analysis of the Drosophila Gs Gene

One of the best understood signal transduction pathways activated by receptors containing seven transmembrane domains involves activation of heterotrimeric G-protein complexes containing Gs , the subsequent stimulation of adenylyl cyclase, production of cAMP, activation of protein kinase A (PKA), and the phosphorylation of substrates that control a wide variety of cellular responses. Here, we report the identification of “loss-of-function” mutations in the Drosophila Gs gene (dgs). Seven mutants have been identified that are either complemented by transgenes representing the wild-type dgs gene or contain nucleotide sequence changes resulting in the production of altered Gs protein. Examination of mutant alleles representing loss-of-Gs function indicates that the phenotypes generated do not mimic those created by mutational elimination of PKA. These results are consistent with the conclusion reached in previous studies that activation of PKA, at least in these developmental contexts, does not depend on receptor-mediated increases in intracellular cAMP, in contrast to the predictions of models developed primarily on the basis of studies in cultured cells. AN expanding array of extracellular signals mediates this scheme, the -subunit plays a key role since it is responsible for coordinating the coupling of receptors cellular responses through a family of receptors possessing seven transmembrane domains (7TMR). Esto appropriate effectors (Neer 1995; Hamm 1998). There are hundreds of receptors that mediate their sential components of the intracellular signal transduction cascade initiated by activation of these receptors intracellular effects through this pathway, yet only 16 genes are known to encode heterotrimeric G-protein are intermediary heterotrimeric G-proteins composed of -, -, and -subunits that couple receptors to appro-subunits in mammals (Neer 1995). Thus, the -subunits can be considered a “bottleneck” in this transducpriate intracellular effectors (for recent reviews see Hamm 1998; Morris and Malbon 1999). In this pathtion cascade since many 7TMR may couple to the same -subunit to mediate cellular responses in different conway, ligand binding by a receptor drives a conformational change in the -subunit of the heterotrimeric texts. Perhaps the best understood example of this signal G-protein, catalyzing the exchange of bound GDP for GTP. The activated, GTP-bound form of the -subunit transduction pathway involves 7TMR coupling to heterotrimeric G-protein complexes containing -subunits in the then dissociates from the -subunits. Each released component can then activate a variety of downstream Gs family, one of the first proteins in this family to be identified (Gilman 1989). When activated, Gs stimueffectors. The signal is terminated by hydrolysis of the GTP to GDP by a GTPase activity intrinsic to the lates membrane-bound, metazoan adenylyl cyclases (AC), resulting in the elevation of intracellular levels of -subunit, allowing its reassociation with the -dimer, thereby reforming the initial complex. In the case of the key second messenger, cAMP (Tesmer and Sprang 1998; Hurley 1999; Simonds 1999). Although adenylyl some G-proteins, the GTPase activity of the -subunit can be stimulated by a family of proteins containing a cyclases, as coincidence detectors, can also be activated by a number of other mechanisms, receptor-dependent conserved RGS domain (De Vries and Gist-Farquhar 1999). This signaling pathway plays a key role in trigelevation of cAMP is mediated primarily through Gs (Bourne and Nicoll 1993; Smit and Iyengar 1998). gering physiological responses to a wide variety of horThe primary role of intracellular cAMP has been extenmones, neurotransmitters, and sensory stimuli and is sively studied and is believed to involve the activation one of the most evolutionarily ancient forms of transof protein kinase A (PKA; Insel et al. 1975; Coffino et al. membrane signal transduction known in eukaryotes. In 1976; Gottesman 1980, 1985; Gottesman et al. 1980). Binding of cAMP by inhibitory regulatory subunits of PKA mediates their dissociation from catalytic subunits, Corresponding author: Michael Forte, Vollum Institute, L474, Oregon Health Sciences University, 3181 S.W. Sam Jackson Park Rd., Portland, thereby leading to kinase activation (Francis and CorOR 97201. E-mail: [email protected] bin 1994). PKA-mediated phosphorylation of a variety of 1 Present address: School of Animal and Microbial Sciences, Universubstrates in turn controls diverse cellular phenomena sity of Reading, Whiteknights, P.O. Box 228, Reading RG6 6AJ, England. such as metabolism, development, cell proliferation, gene Genetics 158: 1189–1201 ( July 2001) 1190 W. J. Wolfgang et al. transcription, and learning and memory. In addition, contain the seven transmembrane domains typically cell-specific responses to activation of Gs pathways, found in 7TMR are encoded (Brody and Cravchik which may be based on selective expression of receptor 2000). Previous studies have identified and characterand AC isoforms (Cooper et al. 1995), the selective ized a number of fly receptors (primarily for biogenic activation of specific intracellular pools of PKA (Colamines) that activate mammalian Gs in cultured cell ledge and Scott 1999; Edwards and Scott 2000; systems, resulting in the stimulation of adenylyl cyclase Skalhegg and Tasken 2000), or activation of other and increases in cAMP (Witz et al. 1990; Sugamori et effectors of cAMP such as cyclic nucleotide-gated chanal. 1995; Han et al. 1996, 1998). In addition, six genes nels (Broillet and Firestein 1999; Biel et al. 1999), in Drosophila encode G-protein -subunits and three have also been documented. However, the exact contriencode and -subunits (Adams et al. 2000). The Drobution of any of these factors to the cAMP-mediated sophila genome also encodes at least seven adenylyl responses in specific cell types has yet to be precisely cyclase isoforms (Cann and Levin 1998; Brody and defined. Cravchik 2000), one of which (that encoded by the The identification of a number of alterations in the rutabaga gene) has been shown to be activated by GTPhuman Gs protein as the cause of a variety of human bound Gs , as are all known isoforms of mammalian diseases, as well as genetic analysis of the gene encoding adenylyl cyclase (Levin et al. 1992; Cooper et al. 1995; Gs in mice and Caenorhabditis, has emphasized the Simonds 1999). In addition, phenotypes generated by critical role of this pathway in metazoan development mutations in the dunce gene, encoding a cAMP-specific and homeostasis. Albright’s hereditary osteodystrophy, phosphodiesterase responsible for the degradation of which is characterized by multihormone resistance, is cAMP, have been extensively studied at a number of associated with heterozygosity for loss-of-function mutalevels (Davis and Dauwalder 1991; Nighorn et al. tions in the single human Gs gene, although the spec1994; Davis 1996). These results, combined with the trum of defects present depends on whether the mutant presence in Drosophila of a number of PKA isoforms gene is inherited maternally or paternally (for reviews (Kalderon and Rubin 1988; Lane and Kalderon 1993; see Spiegel 1997a,b; Farfel et al. 1999). Homozygous Melendez et al. 1995), suggest that genetic manipulanull individuals have not been identified and may not tion in Drosophila may provide an important system in survive, presumably due to major developmental defects which to define the role of this pathway in the developresulting in embryonic lethality. Consistent with this ment and function of specific cell types and to examine conclusion, mice in which the expression of Gs has how signals generated on activation of this pathway are been eliminated die at an early embryonic stage (E10.5; integrated with other signaling events. Yu et al. 1998). In addition, loss-of-function mutations Past work has shown that a single Drosophila gene is in the Caenorhabditis gene encoding Gs , gsa-1, result responsible for encoding a Gs protein that is highly in embryonic lethality (Korswagen et al. 1997). Conhomologous to mammalian orthologs (71% identity; versely, mutations that cripple the GTPase activity of the Quan et al. 1989; Quan and Forte 1990). Drosophila Gs protein, thereby leading to constitutive activation of Gs has been demonstrated to functionally complement the pathway or “gain-of-function” phenotypes, are found the absence of mammalian Gs in specific somatic cell in a variety of pituitary and thyroid malignancies and line mutants, demonstrating that this protein is the funcin a number of endocrine disorders such as McCunetional, as well as structural, homolog of mammalian Gs Albrights syndrome (Spiegel 1997a; Farfel et al. 1999). (Quan et al. 1991). Although ubiquitously expressed in Interestingly, disorders resulting from gain-of-function all cells, highest levels of Gs protein are found in the mutations in Gs arise somatically and are not heritable, Drosophila nervous system (Wolfgang et al. 1990, indicating that gain-of-function, as well as loss-of-func1991). In addition, the phenotypic consequences of contion, mutations lead to major developmental abnormalistitutive activation of Gs pathways have been examined ties. In addition, expression of mutationally activated by the regulated expression of mutant Drosophila Gs forms of Gs in Caenorhabditis leads to neuronal deproteins in which the intrinsic GTPase activity of the generation (Korswagen et al. 1997, 1998; Berger et al. protein was eliminated (Wolfgang et al. 1996; Con1998). nolly et al. 1996; Chyb et al. 1999). The gain-of-function In all mammalian systems, the ability to examine in phenotypes generated in these studies depended on the detail the developmental consequences of genetic alterprecise temporal and spacial pattern of mutant Gs ation of the pathway defined by Gs are limited by the expression, indicating that the role of Gs -mediated intractability of the embryo and the difficulty of genetic signaling depends in large part on the cellular context. manipulations. By contrast, the ease with which genetic Furthermore, we found that, in one case, the phenotype and embryological manipulations are carried out in produced by activation of Gs pathways (alterations in Drosophila makes it a valuable system in which to examcellular adhesion of wing epithelia) did not require the ine mutations in the Gs pathway and their consepresence of PKA (Wolfgang et al. 1996). This observaquences for development. Sequence analysis of the Drosophila genome indicates that over 200 proteins that tion suggests the existence of additional primary ef1191 Mutational Analysis of Gs TABLE 1 fectors of Gs activation, and perhaps cAMP, other than PKA in at least this cell type, if not others. Stocks To complement these gain-of-function studies, in this article we report the results of an F2 lethal screen aimed Df(2R)or, cn[1] bw[1] sp[1]/SM6a at the identification of loss-of-function mutations in the w*; P{w mW.hs FRT(whs)}G13 L*/CyO Drosophila Gs gene (dgs). Seven mutants that are eiP{w mW.hs whs }G13 P{w mC ovo} P{w mC ovo}/Dp(?;2)bw, S, wg Ms(2)M1 ther complemented by transgenes representing the bw/CyO ! ovoD1 FRT 2R 42B wild-type dgs gene or contain nucleotide sequence w[*]; In(2LR)noc[4L]Sco[rv9R], b[1]/CyO, changes resulting in the production of altered Gs proP{ActGFP}JMR1 tein have been identified. Examination of the phenoy;cn, bw, sp types generated by mutations representing loss of Gs P{ry t7.2 neoFRT}42D; ry605 function suggest that the activity of PKA in these conIn(2LR)lt/Cy , Roi texts does not depend on signaling through Gs , since cn;ry,e/SM6 eve-lacz,Roi yw P{w hs-flp}122 ;CyO/Sp loss of Gs does not result in phenotypes generated on mutational elimination of PKA, consistent with conclusions reached in previous examination of gain-of-function phenotypes (Wolfgang et al. 1996). Thus, our embryos with 50% bleach, then permeabilizing by washing with isopropanol, n-hexane, Drosophila Ringer solution and results are consistent with the view that receptor-depenmodified Drosophila Ringer’s solution (MDR; 9 mm MgCl2, dent activation of adenylyl cyclase through Gs in the 10 mm MgSO4, 3 mm NaH2PO4, 68 mm glutamic acid, 67 mm production of cAMP is not necessarily coupled in a glycine, 4 mm malic acid, 0.2 mm Na acetate, 5 mm CaCl2, dependent fashion to the activation of PKA. and 0.1% bovine serum albumin). Embryos were stained for -gal activity by resuspension in 1 ml of 0.5 MDR containing 60 l of 20 mg/ml X-gal dissolved in dimethyl formamide, 40 l 0.1 m K4Fe(CN)6, and 40 l 0.1 m K3Fe(CN)6. Several MATERIALS AND METHODS homozygous mutant embryos identified by the absence of -gal staining were removed and stored in MDR at 80 . DNA Fly stocks, EMS mutagenesis, and dgs rescue constructs: Stocks were obtained either from the Bloomington Stock Cenfrom mutant embryos was extracted by homogenizing embryos in 10 l of extraction buffer (Gloor et al. 1991). ter or colleagues (S. Smolik and D. Kalderon; Table 1). Flies were mutagenized by first starving 2to 4-day-old cn;ry, e The dgs gene contains nine exons (Quan and Forte 1990) including alternate initial exons encoding 5 untranslated semales for 6 hr. Starved flies were then allowed access to 24 mm ethyl methanesulfonate (EMS; Sigma, St. Louis) in 5% quences. PCR amplification of the dgs gene coding sequence in mutant embryos employed three sets of primers generating sucrose for 21 hr. Treated males were then crossed en masse to CyO/Gla females. Subsequent crosses were as described in products that represent exons 2–4 (5 CGGAATTCCTGGAG CAGAACGGAGAAAGCAC 3 and 5 CGGGATCCGTTTGGC results. The Drosophila gene encoding Gs [dgs; also known as G-salpha60A (Adams et al. 2000)] maps to position 60A12 TCAACACATCGATGGC 3 ), exons 5–7 (5 CGGAATTCGCT TGATTAAGGCACTGAAACCG 3 and 5 CGGGATCCCGA on the second chromosome (Quan et al. 1989; Quan and Forte 1990). To remove irrelevant recessive lethal mutations ATTTCTTGGCCAGATCTGAG 3 ), and exons 8 and 9 (5 CGGAATTCCTCAGATCTGGCCAAGAAATTCGC 3 and 5 introduced during EMS mutagenesis, we recombined four alleles (dgs, dgs, dgs, and dgs) onto a cn,bw,sp chroCGGGATCCGGTCATACCAGATCTAAATGCAGCG 3 ). In each case, amplification was done in 40l reactions conmosome by selecting for the absence of sp and acquisition of bw on chromosomes containing dgs mutant alleles, thereby taining 2 l DNA prepared from homozygous mutant embryos (35 cycles consisting of 94 for 30 sec, 55 for 30 sec, and leaving only a small amount of the originally mutated 2R distal to 59E on recombinant chromosomes. We generated three 72 for 30 sec). The products were purified and cloned into pBluescript (Stratagene, La Jolla, CA) following digestion with to five recombinant lines for each allele and each of the recombinants except dgs could be rescued as homozygotes EcoRI and BamHI, and the inserts were sequenced. The position of individual mutations was confirmed by sequence analyby introduction of a dgs transgene (see below), demonstrating that these lines had no second site recessive lethal mutations. sis of DNA prepared from three independent batches of mutant embryos. Since dgs could not be rescued by introduction of the dgs transgene, the chromosome carrying this allele is likely to Lethal phase analysis: To examine embryonic lethality from zygotic mutations, balanced dgs mutant flies were outcrossed contain a linked, second site recessive lethal mutation, presumably in the region distal to 59E derived from the original to wild-type (Canton-S) flies to remove lethality associated with the balancer. The unbalanced mutants were then crossed mutagenized chromosome. A strain carrying a dgs transgene rescue construct (Gs27) inter se and 25% of the fertile eggs assumed to be homozygous mutant. To assess embryonic lethality of progeny from mothwas created by subcloning a 10-kb BamHI fragment containing the entire dgs gene and genomic sequences representing ers with germline dgs clones, progeny were crossed to males carrying dgs mutations over a CyO balancer containing a green roughly 2 kb 5 to the transcriptional initiation site and 2 kb 3 to the translational stop site into pCASPR4 (Pirrotta 1988; fluorescent protein (GFP) expression construct. Nonfluorescent eggs that contained unbalanced maternally and paterQuan and Forte 1990). Transformants were generated by standard procedures. The Gs27 transgene used in this study nally mutant embryos were collected and the percentage of dead embryos determined. To determine the percentage of is located on the X chromosome. Sequence analysis of mutants: Eggs were collected from dead dgs mutant embryos in each case, eggs were collected on egg plates and the number of unhatched eggs determined mutant stocks balanced over a SM6 balancer chromosome containing the eve promoter driving -galactosidase ( -gal). 24 hr after removal of the adults. Unhatched eggs were aged another 3 to 5 days and eggs that turned brown after this Detection of -gal activity was performed by dechorionating 1192 W. J. Wolfgang et al. incubation were scored as dead embryos, and white eggs were reactive protein compared to controls (not shown), sugscored as unfertilized; unfertilized eggs were eliminated from gesting that this deficiency eliminates the dgs gene. further analysis. Thus, male cn;ry 506, e s flies were mutagenized with EMS Generation of clones: Mosaic females carrying dgs germline and crossed en masse to CyO/Gla females. Single F1 CyO clones were generated using the FLP-dominant female sterile (DFS) system (Chou and Perrimon 1992, 1996). Mutant alor Gla males were then mated to virgin Df(2R)orBR11, cn, leles were recombined on to P(w , FRT) chromosomes and bw, sp/SM6, eve-lacz, Roi females. From roughly 4000 yw P{w hs-flp}122; P {w FRT) bw dgs*/CyO females were such crosses, we recovered 120 balanced mutations that crossed to P(w FRT)42B P (w ovo )/CyO males. Progeny were lethal over this deficiency. Of these, 47 were exfrom this cross were heat shocked by incubation at 38 for 1 cluded from further consideration since they were lethal hr, 46 to 60 hr after egg laying. Resulting dgs*/ovo D1 virgins were then collected and crossed to balanced dgs*/CyO-GFP over In(2LR) ltG10 /Cy Roi, an overlapping deficiency that males, and nonfluorescent mutant progeny were examined. does not remove dgs as assessed by immunoblot analysis Histology: For whole mount embryo preparations, embryos (not shown). The 73 remaining balanced lethal mutawere dechorionated in bleach and fixed for 20 min with vigortions were crossed to deficiency stocks containing a dgs ous shaking in a 1:1 mixture of heptane and 4% formaldehyde rescue transgene Gs27; df(2R) orBR11, cn, bw, sp/CyO (ma(Fluka) in phosphate-buffered saline (PBS). Prior to devitellinization, the embryos were collected and washed in PBS conterials and methods). Seven of the lethals were shown taining 0.3% Triton X-100 (PBT; Sigma) and stained for -gal to be in the same complementation group and all but as described above with the addition of 0.3% Triton X-100. Once dgsR19 (which carries a linked, second site recessive lethal a strong -gal reaction was observed, embryos were devitellinmutation; see materials and methods) were rescued ized by vortexing in a 1:1 mixture of heptane and methanol. by the Gs27 transgene. These are denoted as the B19, The devitellinized embryos were hydrated and fixed for 20 min in 4% formaldehyde in PBS and then washed for 1 hr R19, R33, R60, R65, R67, and R79 alleles of the dgs with three changes of PBT containing 10% horse serum. Emgene. bryos were then incubated overnight at 4 in a 1:7500-fold To further confirm that these alleles represent mutadilution of an antisera generated to a unique peptide found tions in the gene encoding Drosophila Gs , the nucleoat the C terminus of all Gs proteins (Wolfgang et al. 1990, tide sequence of several of the dgs alleles (dgsR60, dgsR19, 1991). The antibody binding was then detected using the ABC elite HRP kit (Vector, Burlingame, CA). Embryos were and dgsB19) was determined. The dgs gene contains nine dehydrated, transferred to methylsalycylate (Sigma), and exons that include alternate initial exons encoding 5 mounted in a 1:4 mixture of methylsalycylate and Permount. untranslated sequences (Quan and Forte 1990). SeLarval locomotion assay: Larval crawling activity was meaquence analysis of the coding region (exons 2–9) of sured in a manner similar to that described in Pereira et al. three independent preparations of genomic DNA from (1995). Third instar feeding-stage larvae were collected from staged, uncrowded vials. Single larvae were placed in the cenhomozygous mutant embryos for each allele demonter of an egg plate coated with a thin, uniform layer of yeast. strated that dgsR60 is generated by the change of nucleoAfter 5 min at 21 , the path made by larvae through the yeast tide 723 from a T to an A, resulting in the change of was traced onto the lid of the petri dish. The tracings were residue 241 from a Tyr to a stop codon; dgsR19 by the scanned and the path length was measured using National change of nucleotide 795 from a G to an A, resulting Institutes of Health IMAGE. Measurement of cAMP: To assess cAMP levels in dgs muin the change of residue 265 from a Trp to a stop codon; tants, nonfluorescent first instar larvae from stocks of individand dgsB19 by the change of nucleotide 1117 from an A ual dgs mutations maintained over a CyO balancer chromoto a T, resulting in the change of residue 373 from an some carrying a GFP expression construct were collected by Ile to a Phe. These results demonstrate that the mutants hand and stored at 80 . Larvae were resuspended in iceidentified in this screen represent mutations in the gene cold 5% trichloroacetic acid and homogenized by sonication. Extracts were then spun at 4 at 4000 g for 15 min. Resultencoding the Drosophila Gs protein. ing pellets were then assayed for protein content and supernaLethal phase analysis: Initial characterization of all tants extracted two times with acidified ether. Following exalleles except dgsB19 indicated that each results in lethaltraction, supernatants were dried and residue dissolved in cold ity at late embryonic or early first instar stages. To quan0.5 ml 0.1 m Tris-HCl ph 7.5, 0.01 m EDTA. Levels of cAMP tify the extent of embryonic lethality, we first outcrossed were determined by competitive binding to cAMP binding protein using a commerical kit (Diagnostic Products). balanced mutant lines to Canton-S flies to remove lethality associated with the chromosomes not carrying the dgs gene. Unbalanced offspring were crossed in heteroRESULTS allelic or homoallelic combinations and to Df(2R)orBR11, cn, bw, sp/SM6a. In such crosses, 25% of all progeny Isolation of mutations in the Drosophila Gs gene: Since loss-of-function mutations in genes encoding Gs contain two mutant alleles or, in crosses to the deficiency, progeny were hemizygous for the individual alin both mice and Caenorhabditis result in lethality, we performed an F2 lethal screen to recover mutations in leles. Table 2 shows that in heteroallelic combinations, the percentage of mutant embryos that die is low, rangthe gene (dgs) encoding the Drosophila Gs protein. The screen was based on the observation that immuing from 5 to 14%, while embryonic lethality was generally higher when the four alleles were tested as homozynoblots of extracts prepared from Df(2R)orBR11, cn, bw, sp/SM6, eve-lacz, Roi flies probed with Gs -specific antigotes (6 to 61%) or hemizygotes (10 to 34%). In all allelic combinations and in hemizygotes (except those bodies had approximately half the amount of immuno1193 Mutational Analysis of Gs